Cancer Research Technology
Log in Register

pMV306hsp-luxG13 Vector

Invented by Gavin Reed at Imperial College


Backbone Size (bp) 4373
Bacterial Resistance Kanamycin
Vector Type pMV306hsp
Antigen/Gene or Protein Targets Bacterial luciferase operon + G13 promoter
Relevance Bacterial luciferases can be detected non-invasively in live mice. These reporter plasmidscan be used for research into tuberculosis treatments or the pathogenesis of M. tuberculosis and othe mycobacterial species in vivo.
Research Area Bacteriology
Notes Insert alternative name: LuxABCDE
Species: Mycobacterium marinum + Photorhabdus luminescens
Insert Size (bp): 6186
Mutation: It contains a gram-positive enhanced translation signal in front of luxA, luxC and luxE. G13 promoter cloned in front of luxC
Cloning method: Restriction Enzyme
5′ cloning site: EcoRI (not destroyed)
3′ cloning site: EcoRV (destroyed during cloning)
5′ sequencing primer: agaataacgttggcactcgc
Vector type Bacterial Expression
Growth Temperature 37°C
Growth Strain(s) DH5alpha
Copy number Low Copy
A portion of this plasmid was derived from a plasmid made by Genes were cloned from vector pSB2025 obtained from Dr. Phil Hill at Nottingham University.


There are 1 reference entries for this reagent.

View All References

References: 1 entry

Andreu et al. 2010. PLoS One. 5(5):e10777. PMID: 20520722.

Add a reference

References: 1 entry

Andreu et al. 2010. PLoS One. 5(5):e10777. PMID: 20520722.

Add a reference