Cancer Research Technology
Log in Register
Menu

Info

Catalogue Number 153737
Antigen/Gene or Protein Targets TLR7
Parental Line RAW264.7
Synonyms Mouse macrophage transformed cell line
Host Mouse
Relevance RNA sensor, host-pathogen inteactions
Production Details Cas9 ribonucleoprotein (RNP) assembly was performed following the manufacturer's recommendations (IDT). Briefly, Alt-R® CRISPR-Cas9 crRNA and tracrRNA were annealed in equimolar concentrations to a final duplex concentration of 45 μM. The crRNA guide sequence employed for this clone was UAUGGGACAUUAUAACAUCGGUUUUAGAGCUAUGCU
Conditional No
Research Area Immunology
Growth/Phenotype Keywords RAW264.7 cells were grown in complete DMEM (DMEM complemented with 1x antibiotic/antimycotic and 10% fetal bovine serum [FBS]). Cells were regularly tested for mycoplasma contaminations (none were found by PCR). Functional validation of the cells was carried out as follows: TLR ligands were directly added to medium at the following final concentrations: 100 ng/ml Pam3CSK4 (TLR 1/2 agonist, InvivoGen), 10 μg/ml polyI:C (TLR 3 agonist, InvivoGen), 10 ng/ml LPS (TLR 4 agonist, LPS from E. coli Serotype O111:B4, Enzo Life Sciences), 1 μM R848 (TLR7 agonist, InvivoGen), 0.5–1 μM ODN1826 (TLR9 agonist, T*C*C* A*T*G* A*C*G* T*T*C* C*T*G* A*C*G* T*T, synthesized by IDT and resuspended in RNase-DNase free water) and 0.5 μg/ml Sa19 (TLR13 agonist, rG*rG*rA* rC*rG*rG* rA*rA*rA* rG*rA*rC* rC*rC*rC* rG*rU*rG* rG, synthesized by IDT and resuspended in RNase-DNase free TE buffer). “*” denotes a phosphorothioate modification. “r” denotes an RNA base.
Positive Control Validated by Sanger sequencing and mass spectrometry
Notes Bring back in 100 mm dish and split when 70 - 90% confluent

Sold for research use.If reagent is required for commercialisation purposes, contact Ximbio at enquiries@ximbio.com.

References

There are 0 reference entries for this reagent.

References: 0 entry

There is no reference for this reagent yet, feel free to use the button below to suggest one.

Add a reference

References: 0 entry

There is no reference for this reagent yet, feel free to use the button below to suggest one.

Add a reference