Log in Register
Menu

pMV306hsp-FFluc Vector

Invented by Gavin Reed at Imperial Innovations

Info

Backbone Size (bp) 4373
Bacterial Resistance Kanamycin
Vector Type pMV306hsp
Antigen/Gene or Protein Targets Firefly luciferase
Relevance Firefly luciferases can be detected non-invasively in live mice. These reporter plasmidscan be used for research into tuberculosis treatments or the pathogenesis of M. tuberculosis and othe mycobacterial species in vivo.
Research Area Bacteriology
Notes Insert alternative name: FFluc Luc
Species: Photinus pyralis
Insert Size (bp): 1691
Mutation: Firefly luciferase gene codon optimised for mycobacteria. Lacks the last 3aa
Cloning method: Restriction Enzyme
5′ cloning site: EcoRI (not destroyed)
3′ cloning site: SalI (not destroyed)
5′ sequencing primer: agaataacgttggcactcgc
Vector type: Bacterial Expression
Growth Temperature: 37°C
Growth Strain(s): DH5alpha
Copy number: Low Copy
A portion of this plasmid was derived from a plasmid made by Mycobacteria optimized firefly luciferase gene cloned from pJ246:17659 obtained from Jeff Cirillo (Texas A&M) and Kevin Francis (Caliper Life Sciences)

References: 1 entry

Andreu et al. 2010. PLoS One. 5(5):e10777. PMID: 20520722.


Add a reference

References: 1 entry

Andreu et al. 2010. PLoS One. 5(5):e10777. PMID: 20520722.


Add a reference

References: 1 entry

Andreu et al. 2010. PLoS One. 5(5):e10777. PMID: 20520722.


Add a reference


This reagent does not have any reviews at the moment.