Cancer Research Technology
Log in Register
Menu

CT26TTPKO cell line

Invented by Prof Julian Downward at The Francis Crick Institute

Info

Catalogue Number 157876
Antigen/Gene or Protein Targets Tristetraprolin (TTP)
Parental Line CT26 ATCC-CRL-2638
Synonyms TTP
Host Mouse
Disease Keywords Cancer
Model Knock-Out
Relevance CRISPR/Cas tristetraprolin (TTP) Knock-out KRAS mutant colon carcinoma cell line. In some immunoresistant tumours, PD-L1 expression is upregulated by RAS activation. Via the MEK pathway, the MK2 kinase phosporylates and inhibits TTP, which negatively regulates PD-L1 expression. PD-L1 is a therapeutic target to check the immune evasion mechanism of some cancers.
Production Details CRISPR/Cas TTP Knock-out KRAS mutant colon carcinoma cell line.
Knock Out of functional TTP was confirmed by Western blot. Complete
Zfp36 allele disruption was confirmed by TOPO-TA cloning followed by
sequencing.

Mouse Zfp36 was targeted with gRNA sequence
GTCATGGCTCATCGACTGGAGG, using U6gRNA-Cas9-2A-GFP
Conditional No
Research Area Cancer, Cell Cycle, Cell Signaling & Signal Transduction
Recommended Growing Conditions RPMI-1640 + 10% FCS. Subculture split ratio of 1:4 to 1:10 every 2-3 days.

References

There are 1 reference entries for this reagent.

View All References

References: 1 entry

Coelho et al. 2017. Immunity. 47(6):1083-1099.e6. PMID: 29246442.


Add a reference

References: 1 entry

Coelho et al. 2017. Immunity. 47(6):1083-1099.e6. PMID: 29246442.


Add a reference