Cancer Research Technology
Log in Register
Menu

CT26 TTPKO cell line
RECENTLY UPDATED

Invented by Prof Julian Downward from Francis Crick Institute
Invented at The Francis Crick Institute

Info

Catalogue Number 157876
Antigen/Gene or Protein Targets Tristetraprolin (TTP)
Parental Line CT26 ATCC-CRL-2638
Synonyms TTP
Host Mouse
Disease Keywords Cancer
Model Knock-Out
Relevance CRISPR/Cas tristetraprolin (TTP) Knock-out KRAS mutant colon carcinoma cell line. In some immunoresistant tumours, PD-L1 expression is upregulated by RAS activation. Via the MEK pathway, the MK2 kinase phosporylates and inhibits TTP, which negatively regulates PD-L1 expression. PD-L1 is a therapeutic target to check the immune evasion mechanism of some cancers.
Production Details CRISPR/Cas TTP Knock-out KRAS mutant colon carcinoma cell line.Knock Out of functional TTP was confirmed by Western blot. CompleteZfp36 allele disruption was confirmed by TOPO-TA cloning followed bysequencing.Mouse Zfp36 was targeted with gRNA sequenceGTCATGGCTCATCGACTGGAGG, using U6gRNA-Cas9-2A-GFP
Conditional No
Research Area Cancer, Cell Cycle, Cell Signaling & Signal Transduction
Recommended Growing Conditions RPMI-1640 + 10% FCS. Subculture split ratio of 1:4 to 1:10 every 2-3 days.
Notes CRISPR edited CT26 cells.

Cancer Research Technology Limited (trading research tools as Ximbio) has been granted a non-exclusive license to the CRISPR-Cas9 technology by ERS Genomics Ltd under the patent rights listed here.

This license from ERS Genomics Ltd allows Ximbio to develop and commercialise CRISPR-Cas9 modified cell lines for research use only. Ximbio can provide these modified CRISPR-Cas9 cell lines to companies under a label-use only license.

References

There are 1 reference entries for this reagent.

View All References

References: 1 entry

Coelho et al. 2017. Immunity. 47(6):1083-1099.e6. PMID: 29246442.


Add a reference

References: 1 entry

Coelho et al. 2017. Immunity. 47(6):1083-1099.e6. PMID: 29246442.


Add a reference