Cancer Research Technology
Log in Register

HeLa FRT/TO (YFP-Astrin 4A siRNA res) cell line

Invented by Duccio Conti, at Queen Mary University of London Viji M. Draviam at Queen Mary University of London


Catalogue Number 157864
Parental Line HeLa cell line
Synonyms HeLa FRT/TO YFP-Astrin WT cell line conditionally expressing siRNA-resistant YFP-Astrin WT.
Host Human
Tissue Cervix
Model Cancer Model
Production Details HeLa FRT/TO YFP-Astrin 4A cell line conditionally expressing siRNA-resistant YFP-Astrin 4A.

Created by transfection of HeLa Flp recombinase cell line with pCDNA5-FRT/TO-YFP-Astrin 4A expression plasmid, followed by a brief Hygromycin selection and sorting for YFP positive using FACS.
Research Area Cell Type or Organelle Marker, Cell Structure and Motility, Cell Signaling & Signal Transduction, Cell Cycle, Cancer
Notes siRNA oligos to target Astrin mRNA 5’ UTR (GACUUGGUCUGAGACGUGAtt) or Astrin 52 oligo (UCCCGACAACUCACAGAGAAAUU).
Astrin-4A mutant (RVMF to AAAA substitution) was generated using site directed mutagenesis.


There are 1 reference entries for this reagent.

View All References

References: 1 entry


Add a reference

References: 1 entry


Add a reference

Inventor Information


Duccio Conti

Duccio Conti

Viji M. Draviam

Viji M. Draviam

Add an inventor