HeLa FRT/TO (YFP-Astrin WT siRNA res) cell line
Invented by Duccio Conti , Viji M. Draviam
Invented at Queen Mary University of London
- Datasheet
- References (1)
- Inventor Info
Info
| Catalogue Number | 157863 |
| Parental Line | HeLa cell line |
| Synonyms | HeLa FRT/TO YFP-Astrin WT cell line conditionally expressing siRNA-resistant YFP-Astrin WT. |
| Host | Human |
| Tissue | Cervix |
| Model | Cancer Model |
| Production Details |
HeLa FRT/TO YFP-Astrin WT cell line conditionally expressing siRNA-resistant YFP-Astrin WT. Created by transfection of HeLa Flp recombinase cell line with pCDNA5-FRT/TO-YFP-Astrin WT expression plasmid, followed by a brief Hygromycin selection and sorting for YFP positive using FACS. |
| Research Area | Cell Type or Organelle Marker, Cell Structure and Motility, Cell Signaling & Signal Transduction, Cell Cycle, Cancer |
| Notes | siRNA oligos to target Astrin mRNA 5’ UTR (GACUUGGUCUGAGACGUGAtt) or Astrin 52 oligo (UCCCGACAACUCACAGAGAAAUU). |
References: 1 entry
References: 1 entry
Inventor Information
Inventors
|
Duccio Conti |
|
|
Viji M. Draviam |
