Cancer Research Technology
Log in Register
Menu

HeLa FRT/TO (YFP-Astrin WT siRNA res) cell line

Invented by Duccio Conti, at Queen Mary University of London Viji M. Draviam at Queen Mary University of London

Info

Catalogue Number 157863
Parental Line HeLa cell line
Synonyms HeLa FRT/TO YFP-Astrin WT cell line conditionally expressing siRNA-resistant YFP-Astrin WT.
Host Human
Tissue Cervix
Model Cancer Model
Production Details HeLa FRT/TO YFP-Astrin WT cell line conditionally expressing siRNA-resistant YFP-Astrin WT.

Created by transfection of HeLa Flp recombinase cell line with pCDNA5-FRT/TO-YFP-Astrin WT expression plasmid, followed by a brief Hygromycin selection and sorting for YFP positive using FACS.
Research Area Cell Type or Organelle Marker, Cell Structure and Motility, Cell Signaling & Signal Transduction, Cell Cycle, Cancer
Notes siRNA oligos to target Astrin mRNA 5’ UTR (GACUUGGUCUGAGACGUGAtt) or Astrin 52 oligo (UCCCGACAACUCACAGAGAAAUU).

References

There are 1 reference entries for this reagent.

View All References

References: 1 entry

31808746


Add a reference

References: 1 entry

31808746


Add a reference

Inventor Information

Inventors

Duccio Conti

Duccio Conti

Viji M. Draviam

Viji M. Draviam

Add an inventor