Cancer Research Technology
Log in Register
Menu

MMTV TET-LRH-1 Transgenic Mouse

Info

Catalogue Number 153997
Antigen/Gene or Protein Targets Liver Receptor Homolog-1
Disease Keywords Breast Cancer, Colon Cancer, Pregnancy, Inflammatory bowel disease, Lipid metabolism, Steriodogenesis
Synonyms LRH-1
Model Knock-In
Relevance Mouse has no phenotype; when crossed with an appropriate tissuse-specific rtTA line, doxycycline administration to the double transgenic line will induce LRH-1 and DsRed expression in the tissue of interest. Induces key genes to regulate metabolic process, ovarian function, cancer cell proliferation, and steroidogenesis. In the breast, LRH-1 modulates and synergizes with endogenous estrogen signaling to promote breast cancer cell proliferation.
Production Details The pTetOLRH-1transgene was generated from a construct containing the human LRH-1 open reading frame. A Kozak sequence was introduced by site-directed mutagenesis using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) and primers F-Kozak (5-TTAAGCCAAAGAACTGCCTATAATTTCACTCACCATGGCTTCTAATTCAGATACTGGGGATTTACAAG-3) and R-Kozak (5-CTTGTAAATCCCCAGTATCTGAATTAGAAGCCATGGTGAGTGAAATTATAGGCAGTTCTTTGGCTTAA-3). The LRH-1 open reading frame containing the Kozak sequence was then subcloned into the multiple cloning site of the pTRE-Tight-BI-DsRed Express vector (Clontech) after NotI restriction digest. Orientation of the insert was verified by digesting the vector with BamHI. The vector was then linearized using ApaLI and gel purified. The pTetOLRH-1 founder mice were generated by pronuclear injection (MouseWorksService) of the purified transgene, and complete transgene insertion was verified using primers that spanned the 3_ end of the DsRed open reading frame (L1) (forward 5-GCCGATGAACTTCACCTTGT-3 and reverse 5-CGAGGACGTCATCAAGGAGT-3_) and the 3_ end of the LRH-1 open reading frame (L2) (forward 5_-TCGACCACATTTACCGACAA-3 and reverse 5_-TGGCTGATTATGATCCTCTGG-3). MMTVrtTA-pTetOLRH-1 (MMTVtet-LRH-1) double-transgenic mice were generated by crossing pTetOLRH-1 founder females with MMTVrtTA males. Genotyping of double-transgenic animals was performed using the primers for LRH-1 listed above and MTB forward (TGCCGCCATTATTACGACAAGC) and reverse (ACCGTACTCGTCAATTCCAAGGG).
Breeding Information From good breeder to exceptional breeder. It depends on the age of the mouse.
Conditional Yes
Conditional Description It conditionally expresses LRH-1 (and a DsRed fluorescent marker) from a tetracycline-responsive promoter when crossed with a line that expresses the reverse tetracycline-dependent transactivator (rtTA, or “Tet-on”) and is given doxycycline, which activates the LRH-1 / DsRed expression.
Growth/Phenotype Keywords Mouse has no phenotype
Strain C57BL/6
Mouse Genetic Background/Cross History Transgenic mouse that carries the pTRE-LRH-1 obtained by crossing LRH-1Tg x MTB and FVB/N x MTB mice.
Zygosity Homozygous
Positive Control No
Research Area Cancer
Notes Breast Cancer

References

There are 2 reference entries for this reagent.

View All References

References: 2 entries

Lazarus et al. 2014. Endocrinology. 155(5):1606-17. PMID: 24564400.

Conditional overexpression of liver receptor homolog-1 in female mouse mammary epithelium results in altered mammary morphogenesis via the induction of TGF-β.

Europe PMC ID: 24564400


Add a reference

References: 2 entries

Lazarus et al. 2014. Endocrinology. 155(5):1606-17. PMID: 24564400.

Conditional overexpression of liver receptor homolog-1 in female mouse mammary epithelium results in altered mammary morphogenesis via the induction of TGF-β.


Add a reference

Inventor Information

No inventors are currently linked to this reagent.

Add an inventor