Cancer Research Technology
Log in Register
Menu

Info

Catalogue Number 153933
Antigen/Gene or Protein Targets TLR7
Parental Line RAW264.7
Synonyms Mouse macrophage transformed cell line
Host Mouse
Tissue Bone Marrow
Disease Keywords Infectious disease
Model Knock-Out
Relevance RNA sensor, host-pathogen inteactions
Production Details Cas9 ribonucleoprotein (RNP) assembly was performed following the manufacturer's recommendations (IDT). Briefly, Alt-R® CRISPR-Cas9 crRNA and tracrRNA were annealed in equimolar concentrations to a final duplex concentration of 45 μM. The crRNA guide sequence employed for this clone was AUUGUGUACCUGUUCUACUGGUUUUAGAGCUAUGCU
Conditional No
Research Area Metabolism
Recommended Growing Conditions RAW264.7 cells were grown in complete DMEM (DMEM complemented with 1x antibiotic/antimycotic and 10% fetal bovine serum [FBS]). Cells were regularly tested for mycoplasma contaminations (none were found by PCR). Functional validation of the cells was carried out as follows: TLR ligands were directly added to medium at the following final concentrations: 100 ng/ml Pam3CSK4 (TLR 1/2 agonist, InvivoGen), 10 μg/ml polyI:C (TLR 3 agonist, InvivoGen), 10 ng/ml LPS (TLR 4 agonist, LPS from E. coli Serotype O111:B4, Enzo Life Sciences), 1 μM R848 (TLR7 agonist, InvivoGen), 0.5–1 μM ODN1826 (TLR9 agonist, T*C*C* A*T*G* A*C*G* T*T*C* C*T*G* A*C*G* T*T, synthesized by IDT and resuspended in RNase-DNase free water) and 0.5 μg/ml Sa19 (TLR13 agonist, rG*rG*rA* rC*rG*rG* rA*rA*rA* rG*rA*rC* rC*rC*rC* rG*rU*rG* rG, synthesized by IDT and resuspended in RNase-DNase free TE buffer). “*” denotes a phosphorothioate modification. “r” denotes an RNA base.
Positive Control Validated by mass spectrometry
Notes Bring back in 100 mm dish and split when 70 - 90% confluent

Sold for research use.If reagent is required for commercialisation purposes, contact Ximbio at enquiries@ximbio.com.

References

There are 2 reference entries for this reagent.

View All References

References: 2 entries

Ferrand et al. 2018. Front Cell Infect Microbiol. 8:87. PMID: 29616197.

The Use of CRISPR/Cas9 Gene Editing to Confirm Congenic Contaminations in Host-Pathogen Interaction Studies.

Europe PMC ID: 29616197


Add a reference

References: 2 entries

Ferrand et al. 2018. Front Cell Infect Microbiol. 8:87. PMID: 29616197.

The Use of CRISPR/Cas9 Gene Editing to Confirm Congenic Contaminations in Host-Pathogen Interaction Studies.


Add a reference