Cancer Research Technology
Log in Register
Menu

Prox1CreERT2 Mouse

Invented by Dr Taija Makinen at Uppsala University

Info

Catalogue Number 151718
Antigen/Gene or Protein Targets Prox1
Relevance Allows specific and temporally controlled cre-loxP recombination (gene inactivation/activation) in Prox1-expressing tissues, including lymphatic endothelia. Efficient recombination is observed during all developmental stages (embryonic, postnatal) and in adults. Currently no other models are available that allow such efficient and specific targetting of lymphatic vasculature. Transgenic mouse expressing tamoxifen-inducible creERT2 under the control of Prox1 gene promoter
Production Details A cDNA encoding tamoxifen inducible Cre recombinase (CreERT2) followed by SV40 polyadenylation signal was introduced into the start codon of Prox1 in BAC clone RP23-190F21 using homologous recombination in bacteria. The construct was validated by PCR and Southern blot analyses, and used for pronuclear injection into fertilised mouse oocytes. Two founder lines were generated and tested by timed matings with Cre reporter strains, followed by 4-OHT administration, for specificity and efficiency of Cre-mediated recombination. One of the founder lines that gave efficient recombination in all Prox1-expressing tissues was kept for further studies.
Conditional Yes
Conditional Description Cre-ER transgenic
Mouse Genetic Background/Cross History C57Bl6
Zygosity Heterzygous
Research Area Cardiovascular, Cell Signaling & Signal Transduction, Genetic Studies Tools, Neurobiology

References: 18 entries

Bianchi et al. 2015. PLoS One. 10(4):e0122976. PMID: 25849579.

Martinez-Corral et al. 2015. Circ Res. 116(10):1649-54. PMID: 25737499.

Rouhani et al. 2015. Nat Commun. 6:6771. PMID: 25857745.

Roles of lymphatic endothelial cells expressing peripheral tissue antigens in CD4 T-cell tolerance induction.

Europe PMC ID: 25857745

A transgenic Prox1-Cre-tdTomato reporter mouse for lymphatic vessel research.

Europe PMC ID: 25849579

Nonvenous origin of dermal lymphatic vasculature.

Europe PMC ID: 25737499

Park et al. 2014. J Clin Invest. 124(9):3960-74. PMID: 25061877.

Aspelund et al. 2014. J Clin Invest. 124(9):3975-86. PMID: 25061878.

The Schlemm's canal is a VEGF-C/VEGFR-3-responsive lymphatic-like vessel.

Europe PMC ID: 25061878

Lymphatic regulator PROX1 determines Schlemm's canal integrity and identity.

Europe PMC ID: 25061877

Tatin et al. 2013. Dev Cell. 26(1):31-44. PMID: 23792146.

Planar cell polarity protein Celsr1 regulates endothelial adherens junctions and directed cell rearrangements during valve morphogenesis.

Europe PMC ID: 23792146

Chen et al. 2012. J Clin Invest. 122(6):2006-17. PMID: 22622036.

Blood flow reprograms lymphatic vessels to blood vessels.

Europe PMC ID: 22622036

Sabine et al. 2012. Dev Cell. 22(2):430-45. PMID: 22306086.

Mechanotransduction, PROX1, and FOXC2 cooperate to control connexin37 and calcineurin during lymphatic-valve formation.

Europe PMC ID: 22306086

Bazigou et al. 2011. J Clin Invest. 121(8):2984-92. PMID: 21765212.

Genes regulating lymphangiogenesis control venous valve formation and maintenance in mice.

Europe PMC ID: 21765212


Add a reference

References: 18 entries

Bianchi et al. 2015. PLoS One. 10(4):e0122976. PMID: 25849579.

Martinez-Corral et al. 2015. Circ Res. 116(10):1649-54. PMID: 25737499.

Rouhani et al. 2015. Nat Commun. 6:6771. PMID: 25857745.

Roles of lymphatic endothelial cells expressing peripheral tissue antigens in CD4 T-cell tolerance induction.

Europe PMC ID: 25857745

A transgenic Prox1-Cre-tdTomato reporter mouse for lymphatic vessel research.

Europe PMC ID: 25849579

Nonvenous origin of dermal lymphatic vasculature.

Europe PMC ID: 25737499

Park et al. 2014. J Clin Invest. 124(9):3960-74. PMID: 25061877.

Aspelund et al. 2014. J Clin Invest. 124(9):3975-86. PMID: 25061878.

The Schlemm's canal is a VEGF-C/VEGFR-3-responsive lymphatic-like vessel.

Europe PMC ID: 25061878

Lymphatic regulator PROX1 determines Schlemm's canal integrity and identity.

Europe PMC ID: 25061877

Tatin et al. 2013. Dev Cell. 26(1):31-44. PMID: 23792146.

Planar cell polarity protein Celsr1 regulates endothelial adherens junctions and directed cell rearrangements during valve morphogenesis.

Europe PMC ID: 23792146

Chen et al. 2012. J Clin Invest. 122(6):2006-17. PMID: 22622036.

Blood flow reprograms lymphatic vessels to blood vessels.

Europe PMC ID: 22622036

Sabine et al. 2012. Dev Cell. 22(2):430-45. PMID: 22306086.

Mechanotransduction, PROX1, and FOXC2 cooperate to control connexin37 and calcineurin during lymphatic-valve formation.

Europe PMC ID: 22306086

Bazigou et al. 2011. J Clin Invest. 121(8):2984-92. PMID: 21765212.

Genes regulating lymphangiogenesis control venous valve formation and maintenance in mice.

Europe PMC ID: 21765212


Add a reference

References: 18 entries

Bianchi et al. 2015. PLoS One. 10(4):e0122976. PMID: 25849579.

Martinez-Corral et al. 2015. Circ Res. 116(10):1649-54. PMID: 25737499.

Rouhani et al. 2015. Nat Commun. 6:6771. PMID: 25857745.

Roles of lymphatic endothelial cells expressing peripheral tissue antigens in CD4 T-cell tolerance induction.

A transgenic Prox1-Cre-tdTomato reporter mouse for lymphatic vessel research.

Nonvenous origin of dermal lymphatic vasculature.

Park et al. 2014. J Clin Invest. 124(9):3960-74. PMID: 25061877.

Aspelund et al. 2014. J Clin Invest. 124(9):3975-86. PMID: 25061878.

The Schlemm's canal is a VEGF-C/VEGFR-3-responsive lymphatic-like vessel.

Lymphatic regulator PROX1 determines Schlemm's canal integrity and identity.

Tatin et al. 2013. Dev Cell. 26(1):31-44. PMID: 23792146.

Planar cell polarity protein Celsr1 regulates endothelial adherens junctions and directed cell rearrangements during valve morphogenesis.

Chen et al. 2012. J Clin Invest. 122(6):2006-17. PMID: 22622036.

Blood flow reprograms lymphatic vessels to blood vessels.

Sabine et al. 2012. Dev Cell. 22(2):430-45. PMID: 22306086.

Mechanotransduction, PROX1, and FOXC2 cooperate to control connexin37 and calcineurin during lymphatic-valve formation.

Bazigou et al. 2011. J Clin Invest. 121(8):2984-92. PMID: 21765212.

Genes regulating lymphangiogenesis control venous valve formation and maintenance in mice.


Add a reference
Rating
Genotyping method PCR
Method protocol

Primers (100 pmol/ul):

1 = 5Prox1_F TGTCTGTGCCTCCATCTCAG

2 = Prox1Cre_R AGGCAAATTTTGGTGTACGG

Reaction mixture:

DNA (tail lysate) 1

Additional notes This Genotyping protocol was submitted by Taija Makinen