Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAG_smFP FLAG
(Plasmid #59756)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59756 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAG
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    smFP _FLAG
  • Species
    Synthetic
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
  • 3′ sequencing primer ttaaagcagcgtatccacat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG_smFP FLAG was a gift from Loren Looger (Addgene plasmid # 59756 ; http://n2t.net/addgene:59756 ; RRID:Addgene_59756)
  • For your References section:

    High-performance probes for light and electron microscopy. Viswanathan S, Williams ME, Bloss EB, Stasevich TJ, Speer CM, Nern A, Pfeiffer BD, Hooks BM, Li WP, English BP, Tian T, Henry GL, Macklin JJ, Patel R, Gerfen CR, Zhuang X, Wang Y, Rubin GM, Looger LL. Nat Methods. 2015 Jun;12(6):568-76. doi: 10.1038/nmeth.3365. Epub 2015 Apr 27. 10.1038/nmeth.3365 PubMed 25915120