CT26 TTPKO cell line
Invented by Prof Julian Downward from Francis Crick Institute
Invented at The Francis Crick Institute
- Datasheet
- References (1)
- Inventor Info
Info
| Catalogue Number | 157876 |
| Antigen/Gene or Protein Targets | Tristetraprolin (TTP) |
| Parental Line | CT26 ATCC-CRL-2638 |
| Synonyms | TTP |
| Host | Mouse |
| Disease Keywords | Cancer |
| Model | Knock-Out |
| Relevance | CRISPR/Cas tristetraprolin (TTP) Knock-out KRAS mutant colon carcinoma cell line. In some immunoresistant tumours, PD-L1 expression is upregulated by RAS activation. Via the MEK pathway, the MK2 kinase phosporylates and inhibits TTP, which negatively regulates PD-L1 expression. PD-L1 is a therapeutic target to check the immune evasion mechanism of some cancers. |
| Production Details | CRISPR/Cas TTP Knock-out KRAS mutant colon carcinoma cell line.Knock Out of functional TTP was confirmed by Western blot. CompleteZfp36 allele disruption was confirmed by TOPO-TA cloning followed bysequencing.Mouse Zfp36 was targeted with gRNA sequenceGTCATGGCTCATCGACTGGAGG, using U6gRNA-Cas9-2A-GFP |
| Conditional | No |
| Research Area | Cancer, Cell Cycle, Cell Signaling & Signal Transduction |
| Recommended Growing Conditions | RPMI-1640 + 10% FCS. Subculture split ratio of 1:4 to 1:10 every 2-3 days. |
| Notes |
CRISPR edited CT26 cells. Cancer Research Technology Limited (trading research tools as Ximbio) has been granted a non-exclusive license to the CRISPR-Cas9 technology by ERS Genomics Ltd under the patent rights listed here. This license from ERS Genomics Ltd allows Ximbio to develop and commercialise CRISPR-Cas9 modified cell lines for research use only. Ximbio can provide these modified CRISPR-Cas9 cell lines to companies under a label-use only license. |
